by Alec Pankow and Ben Murrell, now maintained by Hugh Murrell
now upgraded to Julia version 1.10.5
- first update all apps
apt updateapt upgrade
- Snakemake
apt-get install -y snakemake
- python3 packages
apt-get install python3-pandasapt-get install python3-seaborn
We recommend you use the juliaup version manager to install julia.
from a terminal you can do this as follows:
curl -fsSL https://install.julialang.org | shThis should install the Julia version manager, juliaup as well as
the latest version of Julia. To find out how to use the version manager
to makesure you have version 1.10.5 as your default, go here:
[https://github.com/JuliaLang/juliaup]
Once Julia is installed, make sure you can enter the julia REPL from the command line and check the version number by logging out and in again
exit
ssh root@.....and then from your new terminal session:
juliaup status
julia --versionIf the version number is not 1.10.5 then you need to use juliaup to install
that version and make it the default.
juliaup add 1.10.5
juliaup default 1.10.5for further details concerning juliaup go here:
[https://github.com/JuliaLang/juliaup?tab=readme-ov-file#using-juliaup]
Now that the dependencies are setup we clone the PORPIDpipeline repository
git clone https://github.com/MurrellGroup/PORPIDpipeline.gitthen navigate to the PORPIDpipeline project folder and start the Julia REPL.
Enter the package manager using ] and then enter
activate .
instantiate
precompileThis will activate, install, and precompile the julia environment specified by the
Project.toml and Manifest.toml files. The precompile command
above is not strictly needed but is useful if there are issues with installing
the julia packages listed in Project.toml
The graph below summarizes the overall organization of the workflow. Each node in the graph is a rule in the The Snakefile.
Snakemake makes use of a Snakefile and a config file to specify
input and output files for each rule and to set parameters for each
rule in the workflow. Global parameters that can be changed by the
user editing the Snakefile are as follows:
# PORPIDpipeline parameters
# demux
chunk_size = 100000 # default 100000
error_rate = 0.01 # default 0.01
min_length = 2100 # default 2100
max_length = 4300 # default 4300
max_reads = 100000 # default 100000 reads per sample,
verbose = "false" # default "false", use "true" to debug demux
#porpid
fs_thresh = 1 # default 1 (or use 5 if af_thresh is 0)
lda_thresh = 0.995 # default 0.995
#consensus
agreement_thresh = 0.7 # default 0.7
af_thresh = 0.35 # default 0.35 (drops smallest 35% of CCS reads)
#contam
cluster_thresh = 0.015 # default 0.015
proportion_thresh = 0.2 # default 0.2
dist_thresh = 0.015 # default 0.015
contam_toggle = "on" # default "on", use "off" to disable
#postproc
panel_thresh = 50 # default 50
#tar
degap = "true" # default "true", use "false" to disable
collapse = "true" # default "true", use "false" to disable
porpid_archive = "full" # default "full", use "part" for partial archive
Note that with the advent of PacBio Revio sequencer, the number of reads
per sample has grown to outstrip memory available on standard CPUs.
To enable a trouble free pipeline run, we now allow the user to specify
the maximum number of reads per sample using the max_reads parameter above.
Samples with reads exceeding this limit are then randomly sub-sampled to
reduce the number of reads accordingly.
We also introduce the option of a partial archive of the intermediate porpid directory. This option is made available to ameliorate the inordinately long time it can take to archive and gzip the huge directory structures produced when processing PacBio Revio datasets.
Parameters for each sample are provided in the config.yaml file. This file
should reflect your library construction, amplicon identity and any override
parameter settings.
It should follow the same format shown in the demo example below.
demo:
donor_1_REN:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAacagtgNNNNNNNNGTCATTGGTCTTAAAGGTACCTG
sec_str_primer: TAGGCATCTCCT
panel: "panels/HIV1_COM_2017_5970-8994_DNA_stripped.fasta"
donor_2_REN:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAcactcaNNNNNNNNGTCATTGGTCTTAAAGGTACCTG
sec_str_primer: TAGGCATCTCCT
panel: "panels/HIV1_COM_2017_5970-8994_DNA_stripped.fasta"
af_override: 0.4
donor_3_REN:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAggtagcNNNNNNNNGTCATTGGTCTTAAAGGTACCTG
sec_str_primer: TAGGCATCTCCT
panel: "panels/HIV1_COM_2017_5970-8994_DNA_stripped.fasta"
donor_1_GP:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAacagtgNNNNNNNNGTATGTCATTGACAGTCCAGC
sec_str_primer: TTGACTAGCGGAGGCTAGAAGGAGA
panel: "panels/HIV1_COM_2017_787-3300_DNA_stripped.fasta"
af_override: 0.3
donor_2_GP:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAcactcaNNNNNNNNGTATGTCATTGACAGTCCAGC
sec_str_primer: TTGACTAGCGGAGGCTAGAAGGAGA
panel: "panels/HIV1_COM_2017_787-3300_DNA_stripped.fasta"
af_override: 0.0
fs_override: 14
donor_3_GP:
cDNA_primer: CCGCTCCGTCCGACGACTCACTATAggtagcNNNNNNNNGTATGTCATTGACAGTCCAGC
sec_str_primer: TTGACTAGCGGAGGCTAGAAGGAGA
panel: "panels/HIV1_COM_2017_787-3300_DNA_stripped.fasta"Note that the donor ID barcode is in lowercase and the Unique Molecular Identifier (UMI) barcode is indicated with N's. The primer sequences provided will be used for demultiplexing and will be trimmed from the final sequences.
The panel arg should be a path to a .fasta alignment spanning your amplicon,
with all gaps stripped. This will be used only in the postproccessing step to remove
off-target seqs and trim to the correct coordinates.
To generate your own panel file you are encouraged to visit:
https://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html
where you can download an alignment and then use aliview to trim
the alignment to your region of interest.
gzipped CCS .fastq files should be placed in the raw-reads/ subdirectory and named
according to the the dataset name used in the config.yaml file, ie, demo.fastq.gz
for the demo dataset.
We also use the config file to allow an override for a particular sample,
of the default artefact filter threshold, and/or, the default family size filter.
See the demo config file above.
Preview jobs with Snakemake and run with {n} cores.
#preview jobs
snakemake -np
#run
snakemake -j{n}
#in the cloud
nohup snakemake -j{n}&
cat nohup.outFor more info on Snakemake, see:
[https://snakemake.readthedocs.io/en/stable/]
Seting up a snakemake pipeline on a cluster is a dark art. Here we describe an attempt
at installing PORPIDpipeline on a two node cluster, (one node a controller node with 16 cores
and the other node a compute node with 64 cores).
Firstly, since the cluster administrator is hardly likely to give you root access we
suggest you follow the conda installation for PORPIDpipeline. If you expect more
than one user of your PORPIDpipeline then install in a directory that all
your users can see and that is visible from both the contoller and compute nodes.
ie use some other directory rather than the standard home directory and make
sure to inform julia about this choice of directory as
outlined in the conda section above.
Secondly, cluster administrators usually insist that large data sets are stored
in an appropriate volume and not in the usual user's space. On our cluster the
administrator required the PORPIDpipeline code to be installed in a \tools\porpid\
directory and the large data sets (input, output and temporary) to be stored in
a \data\porpid\ directory so we installed PORPIDpipeline into \tools\porpid\porpidpipeline
and then replaced some of the directories in the porpidpipeline
directory with symbolic links to an appropriate directory in the \data\porpid\ directory
as shown below
config.yaml -> /raw/porpid/config/demo.yaml
panels -> /raw/porpid/panels/
porpid -> /raw/porpid/porpid/
postproc -> /raw/porpid/postproc/
raw-reads -> /raw/porpid/raw-reads/
Naturally, one must copy contents of the installation to the /raw/porpid/ directory
before deleting the installation directory and replacing it with a symbolic link to the
appropriate place on the raw volume.
Job submission, after setting up like this we are ready to run the demo study through
the PORPIDpipeline
by submitting the snakemake command to the cluster managemant system.
On our cluster that management system is slurm and the following shell script
stored in porpid_job.sh facilitated that submission:
#!/bin/bash
#SBATCH --job-name==porpid
#SBATCH --time=1:0:0
#SBATCH --nodes=1
#SBATCH --ntasks-per-node=7
#SBATCH --partition=main
if [ "$#" -lt 1 ]; then
echo "please supply a config file name as first parameter"
exit
fi
echo "config file is $1"
echo "${SLURM_JOB_NAME} job submited using ${SLURM_NTASKS} cores"
# create a symbolic link for the snakemake config file to point to the config for the current study
rm -f /tools/PORPIDpipeline/porpidpipeline/config.yaml
ln -s /RAW/PORPID/CONFIG/$1.yaml /tools/PORPIDpipeline/porpidpipeline/config.yaml
# tell slurm where anaconda is and conda activate the PORPIDpipeline environment
source /tools/PORPIDpipeline/anaconda3/etc/profile.d/conda.sh
conda activate PORPIDpipeline
# navigate to the porpidpipeline directory and run snakemake
# add -F to to the snakemake command to force re-run of all rules
cd /tools/PORPIDpipeline/porpidpipeline
snakemake --rerun-incomplete -j${SLURM_NTASKS} To submit the demo to run as a slurm batch job one just uses
sbatch porpid_job.sh demoThe script above sets some environment variables for slurm and then resets
the symbolic link to the appropriate config file for the demo study.
It then activates the conda environment switches to the installation
directory and runs the snakemake pipeline.
With this structure it is easy to run a new study through PORPIDpipeline.
One copies the new config file into the /raw/porpid/config/ directory,
transfers the fastq data to the /raw/porpid/raw-reads/ directory
and then issues the sbatch command using the appropriate study name
instead of demo
Note that with this method you must predetermine the number of cores
you intend to use on your cluster's node. In the demo study this is set
to 7 ( 6 cores for the samples to run in parallel plus 1 core for snakemake )
Each study will be different. To see how many samples can be run in parallel
you can do a snakemake dry run using the porpid_dry_run.sh script below:
#!/bin/bash
if [ "$#" -lt 1 ]; then
echo "please supply a config file name as first parameter"
exit
fi
echo "config file is $1"
# create a symbolic link for the snakemake config file to
# point to the config for the current study
rm -f /tools/PORPIDpipeline/porpidpipeline/config.yaml
ln -s /RAW/PORPID/CONFIG/$1.yaml /tools/PORPIDpipeline/porpidpipeline/config.yaml
# activate the conda environment
source /tools/PORPIDpipeline/anaconda3/etc/profile.d/conda.sh
conda activate PORPIDpipeline
# perform a snakemake dry run
# remove the -f for a partial dry run of what's left to do
cd /tools/PORPIDpipeline/porpidpipeline
snakemake -F --rerun-incomplete -npNote that this dry run is not compute intensive and can ve executed on the
controller machine without using the sbatch command as follows:
./porpid_dry_run.sh demoThe above suggestion for running a snakemake pipeline under slurm
is rudamentary. Maximum cores must be requested at the start of execution
and they are probably held throughout the run.
However, it is alledged that snakemake can play nicely with slurm and
it should be possible to have snakemake invoke slurm for each rule in
the pipeline. In this case snakemake would request the optimal number
of cores needed for each step in the pipeline.
We have not attempted this yet, and it would probably require writing a
slurm efficient version of the snakefile.
An introduction to PacBio sequencing and an explanation for each PORPIDpipeline rule is given in the set of introductory slides packaged with this repository. docs/slides/PORPIDpipeline.pdf
To understand how this pipeline was designed and tested please read our Optimized SMRT-UMI protocol paper.
