diff --git a/config/generator_macros.j2 b/config/generator_macros.j2
index 1249d5413..ff7bd3573 100644
--- a/config/generator_macros.j2
+++ b/config/generator_macros.j2
@@ -31,12 +31,17 @@ include("{{ exercise }}.jl")
 {%- endif %}
 {%- endmacro %}
 
-{# A Julia string literal, with \, " and $ escaped #}
+{# A Julia string literal, with \, ", $, newlines and tabs escaped #}
 {% macro julia_string(s) -%}
-"{{ s | replace("\\", "\\\\") | replace('"', '\\"') | replace("$", "\\$") }}"
+"{{ s | replace("\\", "\\\\") | replace('"', '\\"') | replace("$", "\\$") | replace("\n", "\\n") | replace("\t", "\\t") }}"
 {%- endmacro %}
 
 {# A Julia vector literal; string elements are quoted with julia_string, nested lists become nested vectors #}
 {% macro julia_vector(xs) -%}
 [{% for x in xs %}{% if x is string %}{{ julia_string(x) }}{% elif x is sequence %}{{ julia_vector(x) }}{% else %}{{ x }}{% endif %}{% if not loop.last %}, {% endif %}{% endfor %}]
 {%- endmacro %}
+
+{# A Julia Dict literal; string keys are quoted with julia_string, or as Chars if char_keys is true #}
+{% macro julia_dict(d, char_keys=false) -%}
+Dict({% for k, v in d.items() %}{% if char_keys %}'{{ k }}'{% else %}{{ julia_string(k) }}{% endif %} => {% if v is string %}{{ julia_string(v) }}{% elif v is sequence %}{{ julia_vector(v) }}{% else %}{{ v }}{% endif %}{% if not loop.last %}, {% endif %}{% endfor %})
+{%- endmacro %}
diff --git a/exercises/practice/etl/.meta/template.j2 b/exercises/practice/etl/.meta/template.j2
new file mode 100644
index 000000000..7d9dab40f
--- /dev/null
+++ b/exercises/practice/etl/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test transform(Dict({% for score, letters in case["input"]["legacy"].items() %}{{ score }} => [{% for c in letters %}'{{ c }}'{% if not loop.last %}, {% endif %}{% endfor %}]{% if not loop.last %}, {% endif %}{% endfor %})) == {{ macros.julia_dict(case["expected"], char_keys=true) }}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/etl/runtests.jl b/exercises/practice/etl/runtests.jl
index e618deb0a..c2a64bce6 100644
--- a/exercises/practice/etl/runtests.jl
+++ b/exercises/practice/etl/runtests.jl
@@ -1,37 +1,34 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/etl/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("etl.jl")
 
 @testset verbose = true "tests" begin
     @testset "single letter" begin
-        input = Dict(1=>['A'])
-        output = Dict('a'=>1)
-        @test transform(input) == output
+        @test transform(Dict(1 => ['A'])) == Dict('a' => 1)
     end
 
     @testset "single score with multiple letters" begin
-        input = Dict(1=>['A', 'E', 'I', 'O', 'U'])
-        output = Dict('a'=>1, 'e'=>1, 'i'=>1, 'o'=>1, 'u'=>1)
-        @test transform(input) == output
+        @test transform(Dict(1 => ['A', 'E', 'I', 'O', 'U'])) ==
+              Dict('a' => 1, 'e' => 1, 'i' => 1, 'o' => 1, 'u' => 1)
     end
 
     @testset "multiple scores with multiple letters" begin
-        input = Dict(1=>['A', 'E'], 2=>['D', 'G'])
-        output = Dict('g'=>2, 'e'=>1, 'a'=>1, 'd'=>2)
-        @test transform(input) == output
+        @test transform(Dict(1 => ['A', 'E'], 2 => ['D', 'G'])) ==
+              Dict('a' => 1, 'd' => 2, 'e' => 1, 'g' => 2)
     end
 
     @testset "multiple scores with differing numbers of letters" begin
-        input = Dict(1=>[ 'A', 'E', 'I', 'O', 'U', 'L', 'N', 'R', 'S', 'T' ],
-                    2=>[ 'D', 'G' ], 3=>[ 'B', 'C', 'M', 'P' ],
-                    4=>[ 'F', 'H', 'V', 'W', 'Y' ], 5=>[ 'K' ],
-                    8=>[ 'J', 'X' ], 10=>[ 'Q', 'Z' ])
-        output = Dict('a'=>1, 'b'=>3,  'c'=>3, 'd'=>2, 'e'=>1,
-                    'f'=>4, 'g'=>2,  'h'=>4, 'i'=>1, 'j'=>8,
-                    'k'=>5, 'l'=>1,  'm'=>3, 'n'=>1, 'o'=>1,
-                    'p'=>3, 'q'=>10, 'r'=>1, 's'=>1, 't'=>1,
-                    'u'=>1, 'v'=>4,  'w'=>4, 'x'=>8, 'y'=>4,
-                    'z'=>10)
-        @test transform(input) == output
+        @test transform(Dict(1 => ['A', 'E', 'I', 'O', 'U', 'L', 'N', 'R', 'S', 'T'],
+                             2 => ['D', 'G'], 3 => ['B', 'C', 'M', 'P'],
+                             4 => ['F', 'H', 'V', 'W', 'Y'], 5 => ['K'], 8 => ['J', 'X'],
+                             10 => ['Q', 'Z'])) ==
+              Dict('a' => 1, 'b' => 3, 'c' => 3, 'd' => 2, 'e' => 1, 'f' => 4, 'g' => 2,
+                   'h' => 4, 'i' => 1, 'j' => 8, 'k' => 5, 'l' => 1, 'm' => 3, 'n' => 1,
+                   'o' => 1, 'p' => 3, 'q' => 10, 'r' => 1, 's' => 1, 't' => 1, 'u' => 1,
+                   'v' => 4, 'w' => 4, 'x' => 8, 'y' => 4, 'z' => 10)
     end
 end
diff --git a/exercises/practice/food-chain/.meta/template.j2 b/exercises/practice/food-chain/.meta/template.j2
new file mode 100644
index 000000000..b31a221d3
--- /dev/null
+++ b/exercises/practice/food-chain/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test recite({{ case["input"]["startVerse"] }}, {{ case["input"]["endVerse"] }}) == {{ macros.julia_vector(case["expected"]) }}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/food-chain/runtests.jl b/exercises/practice/food-chain/runtests.jl
index cb80528d4..27903f1c1 100644
--- a/exercises/practice/food-chain/runtests.jl
+++ b/exercises/practice/food-chain/runtests.jl
@@ -1,172 +1,131 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/food-chain/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("food-chain.jl")
 
 @testset verbose = true "tests" begin
-
     @testset "fly" begin
-        expected = [
-            "I know an old lady who swallowed a fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die."
-          ]
-        @test recite(1, 1) == expected
+        @test recite(1, 1) == ["I know an old lady who swallowed a fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "spider" begin
-        expected = [
-            "I know an old lady who swallowed a spider.",
-            "It wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(2, 2) == expected
+        @test recite(2, 2) == ["I know an old lady who swallowed a spider.",
+                               "It wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "bird" begin
-        expected = [
-            "I know an old lady who swallowed a bird.",
-            "How absurd to swallow a bird!",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(3, 3) == expected
+        @test recite(3, 3) ==
+              ["I know an old lady who swallowed a bird.", "How absurd to swallow a bird!",
+               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+               "She swallowed the spider to catch the fly.",
+               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "cat" begin
-        expected = [
-            "I know an old lady who swallowed a cat.",
-            "Imagine that, to swallow a cat!",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(4, 4) == expected
+        @test recite(4, 4) ==
+              ["I know an old lady who swallowed a cat.", "Imagine that, to swallow a cat!",
+               "She swallowed the cat to catch the bird.",
+               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+               "She swallowed the spider to catch the fly.",
+               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "dog" begin
-        expected = [
-            "I know an old lady who swallowed a dog.",
-            "What a hog, to swallow a dog!",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(5, 5) == expected
+        @test recite(5, 5) ==
+              ["I know an old lady who swallowed a dog.", "What a hog, to swallow a dog!",
+               "She swallowed the dog to catch the cat.",
+               "She swallowed the cat to catch the bird.",
+               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+               "She swallowed the spider to catch the fly.",
+               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "goat" begin
-        expected = [
-            "I know an old lady who swallowed a goat.",
-            "Just opened her throat and swallowed a goat!",
-            "She swallowed the goat to catch the dog.",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(6, 6) == expected
+        @test recite(6, 6) == ["I know an old lady who swallowed a goat.",
+                               "Just opened her throat and swallowed a goat!",
+                               "She swallowed the goat to catch the dog.",
+                               "She swallowed the dog to catch the cat.",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "cow" begin
-        expected = [
-            "I know an old lady who swallowed a cow.",
-            "I don't know how she swallowed a cow!",
-            "She swallowed the cow to catch the goat.",
-            "She swallowed the goat to catch the dog.",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(7, 7) == expected
+        @test recite(7, 7) == ["I know an old lady who swallowed a cow.",
+                               "I don't know how she swallowed a cow!",
+                               "She swallowed the cow to catch the goat.",
+                               "She swallowed the goat to catch the dog.",
+                               "She swallowed the dog to catch the cat.",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "horse" begin
-        expected = [
-            "I know an old lady who swallowed a horse.", "She's dead, of course!",
-          ]
-        @test recite(8, 8) == expected
+        @test recite(8, 8) ==
+              ["I know an old lady who swallowed a horse.", "She's dead, of course!"]
     end
 
     @testset "multiple verses" begin
-        expected = [
-            "I know an old lady who swallowed a fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a spider.",
-            "It wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a bird.",
-            "How absurd to swallow a bird!",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-      ]
-        @test recite(1, 3) == expected
+        @test recite(1, 3) == ["I know an old lady who swallowed a fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a spider.",
+                               "It wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a bird.", "How absurd to swallow a bird!",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die."]
     end
 
     @testset "full song" begin
-        expected = [
-            "I know an old lady who swallowed a fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a spider.",
-            "It wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a bird.",
-            "How absurd to swallow a bird!",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a cat.",
-            "Imagine that, to swallow a cat!",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a dog.",
-            "What a hog, to swallow a dog!",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a goat.",
-            "Just opened her throat and swallowed a goat!",
-            "She swallowed the goat to catch the dog.",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a cow.",
-            "I don't know how she swallowed a cow!",
-            "She swallowed the cow to catch the goat.",
-            "She swallowed the goat to catch the dog.",
-            "She swallowed the dog to catch the cat.",
-            "She swallowed the cat to catch the bird.",
-            "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
-            "She swallowed the spider to catch the fly.",
-            "I don't know why she swallowed the fly. Perhaps she'll die.",
-            "",
-            "I know an old lady who swallowed a horse.",
-            "She's dead, of course!",
-      ]
-        @test recite(1, 8) == expected
+        @test recite(1, 8) == ["I know an old lady who swallowed a fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a spider.",
+                               "It wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a bird.", "How absurd to swallow a bird!",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a cat.", "Imagine that, to swallow a cat!",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a dog.", "What a hog, to swallow a dog!",
+                               "She swallowed the dog to catch the cat.",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a goat.",
+                               "Just opened her throat and swallowed a goat!",
+                               "She swallowed the goat to catch the dog.",
+                               "She swallowed the dog to catch the cat.",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a cow.",
+                               "I don't know how she swallowed a cow!",
+                               "She swallowed the cow to catch the goat.",
+                               "She swallowed the goat to catch the dog.",
+                               "She swallowed the dog to catch the cat.",
+                               "She swallowed the cat to catch the bird.",
+                               "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.",
+                               "She swallowed the spider to catch the fly.",
+                               "I don't know why she swallowed the fly. Perhaps she'll die.", "",
+                               "I know an old lady who swallowed a horse.", "She's dead, of course!"]
     end
-
-end
\ No newline at end of file
+end
diff --git a/exercises/practice/kindergarten-garden/.meta/template.j2 b/exercises/practice/kindergarten-garden/.meta/template.j2
new file mode 100644
index 000000000..3d6c97937
--- /dev/null
+++ b/exercises/practice/kindergarten-garden/.meta/template.j2
@@ -0,0 +1,21 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{%- macro test_case(case) %}
+{%- if case["cases"] %}
+    @testset "{{ case["description"] }}" begin
+    {%- for subcase in case["cases"] %}
+        {{ test_case(subcase) }}
+    {% endfor %}
+    end
+{%- else %}
+    @testset "{{ case["description"] }}" begin
+        @test plants({{ macros.julia_string(case["input"]["diagram"]) }}, "{{ case["input"]["student"] }}") == {{ macros.julia_vector(case["expected"]) }}
+    end
+{%- endif %}
+{%- endmacro %}
+{% for case in cases %}
+    {{ test_case(case) }}
+{% endfor %}
+end
diff --git a/exercises/practice/kindergarten-garden/runtests.jl b/exercises/practice/kindergarten-garden/runtests.jl
index 876c55a71..1a33eca34 100644
--- a/exercises/practice/kindergarten-garden/runtests.jl
+++ b/exercises/practice/kindergarten-garden/runtests.jl
@@ -1,3 +1,7 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/kindergarten-garden/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("kindergarten-garden.jl")
@@ -7,84 +11,87 @@ include("kindergarten-garden.jl")
         @testset "garden with single student" begin
             @test plants("RC\nGG", "Alice") == ["radishes", "clover", "grass", "grass"]
         end
-        
+
         @testset "different garden with single student" begin
             @test plants("VC\nRC", "Alice") == ["violets", "clover", "radishes", "clover"]
         end
-        
+
         @testset "garden with two students" begin
             @test plants("VVCG\nVVRC", "Bob") == ["clover", "grass", "radishes", "clover"]
         end
-        
-        @testset "second student's garden" begin
-            @test plants("VVCCGG\nVVCCGG", "Bob") == ["clover", "clover", "clover", "clover"]
-        end
-        
-        @testset "third student's garden" begin
-            @test plants("VVCCGG\nVVCCGG", "Charlie") == ["grass", "grass", "grass", "grass"]
+
+        @testset "multiple students for the same garden with three students" begin
+            @testset "second student's garden" begin
+                @test plants("VVCCGG\nVVCCGG", "Bob") ==
+                      ["clover", "clover", "clover", "clover"]
+            end
+
+            @testset "third student's garden" begin
+                @test plants("VVCCGG\nVVCCGG", "Charlie") ==
+                      ["grass", "grass", "grass", "grass"]
+            end
         end
     end
 
     @testset "full garden" begin
         @testset "for Alice, first student's garden" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Alice") == ["violets", "radishes", "violets", "radishes"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Alice") ==
+                  ["violets", "radishes", "violets", "radishes"]
         end
 
         @testset "for Bob, second student's garden" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Bob") == ["clover", "grass", "clover", "clover"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Bob") ==
+                  ["clover", "grass", "clover", "clover"]
         end
 
         @testset "for Charlie" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Charlie") == ["violets", "violets", "clover", "grass"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Charlie") ==
+                  ["violets", "violets", "clover", "grass"]
         end
 
         @testset "for David" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "David") == ["radishes", "violets", "clover", "radishes"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "David") ==
+                  ["radishes", "violets", "clover", "radishes"]
         end
 
         @testset "for Eve" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Eve") == ["clover", "grass", "radishes", "grass"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Eve") ==
+                  ["clover", "grass", "radishes", "grass"]
         end
 
         @testset "for Fred" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Fred") == ["grass", "clover", "violets", "clover"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Fred") ==
+                  ["grass", "clover", "violets", "clover"]
         end
 
         @testset "for Ginny" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Ginny") == ["clover", "grass", "grass", "clover"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Ginny") ==
+                  ["clover", "grass", "grass", "clover"]
         end
 
         @testset "for Harriet" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Harriet") == ["violets", "radishes", "radishes", "violets"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Harriet") ==
+                  ["violets", "radishes", "radishes", "violets"]
         end
 
         @testset "for Ileana" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Ileana") == ["grass", "clover", "violets", "clover"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Ileana") ==
+                  ["grass", "clover", "violets", "clover"]
         end
 
         @testset "for Joseph" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Joseph") == ["violets", "clover", "violets", "grass"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Joseph") ==
+                  ["violets", "clover", "violets", "grass"]
         end
 
         @testset "for Kincaid, second to last student's garden" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Kincaid") == ["grass", "clover", "clover", "grass"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Kincaid") ==
+                  ["grass", "clover", "clover", "grass"]
         end
 
         @testset "for Larry, last student's garden" begin
-            diagram = "VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV"
-            @test plants(diagram, "Larry") == ["grass", "violets", "clover", "violets"]
+            @test plants("VRCGVVRVCGGCCGVRGCVCGCGV\nVRCCCGCRRGVCGCRVVCVGCGCV", "Larry") ==
+                  ["grass", "violets", "clover", "violets"]
         end
-
     end
 end
diff --git a/exercises/practice/nucleotide-count/.meta/template.j2 b/exercises/practice/nucleotide-count/.meta/template.j2
new file mode 100644
index 000000000..7d99aaa7c
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/template.j2
@@ -0,0 +1,14 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+    {%- if case is error_case %}
+        @test_throws DomainError count_nucleotides("{{ case["input"]["strand"] }}")
+    {%- else %}
+        @test count_nucleotides("{{ case["input"]["strand"] }}") == {{ macros.julia_dict(case["expected"], char_keys=true) }}
+    {%- endif %}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/nucleotide-count/runtests.jl b/exercises/practice/nucleotide-count/runtests.jl
index c77a08bd8..73f389ce5 100644
--- a/exercises/practice/nucleotide-count/runtests.jl
+++ b/exercises/practice/nucleotide-count/runtests.jl
@@ -1,3 +1,7 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/nucleotide-count/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("nucleotide-count.jl")
@@ -7,7 +11,7 @@ include("nucleotide-count.jl")
         @test count_nucleotides("") == Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
     end
 
-    @testset "strand with one nucleotide in single-character input" begin
+    @testset "can count one nucleotide in single-character input" begin
         @test count_nucleotides("G") == Dict('A' => 0, 'C' => 0, 'G' => 1, 'T' => 0)
     end
 
@@ -16,7 +20,8 @@ include("nucleotide-count.jl")
     end
 
     @testset "strand with multiple nucleotides" begin
-        @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") == Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
+        @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") ==
+              Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
     end
 
     @testset "strand with invalid nucleotides" begin
diff --git a/exercises/practice/proverb/.meta/template.j2 b/exercises/practice/proverb/.meta/template.j2
new file mode 100644
index 000000000..37f70dbef
--- /dev/null
+++ b/exercises/practice/proverb/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test recite({{ macros.julia_vector(case["input"]["strings"]) }}) == {{ macros.julia_string(case["expected"] | join("\n")) }}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/proverb/runtests.jl b/exercises/practice/proverb/runtests.jl
index 703ef9a63..7e7b9eaa8 100644
--- a/exercises/practice/proverb/runtests.jl
+++ b/exercises/practice/proverb/runtests.jl
@@ -1,56 +1,37 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/proverb/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
+
 include("proverb.jl")
 
 @testset verbose = true "tests" begin
     @testset "zero pieces" begin
-        pieces = []
-        expected = ""
-        @test recite(pieces) == expected
+        @test recite([]) == ""
     end
 
     @testset "one piece" begin
-        pieces = ["nail"]
-        expected = "And all for the want of a nail."
-        @test recite(pieces) == expected
+        @test recite(["nail"]) == "And all for the want of a nail."
     end
 
     @testset "two pieces" begin
-        pieces = ["nail", "shoe"]
-        expected = """
-            For want of a nail the shoe was lost.
-            And all for the want of a nail."""
-        @test recite(pieces) == expected
+        @test recite(["nail", "shoe"]) ==
+              "For want of a nail the shoe was lost.\nAnd all for the want of a nail."
     end
 
     @testset "three pieces" begin
-        pieces = ["nail", "shoe", "horse"]
-        expected = """
-            For want of a nail the shoe was lost.
-            For want of a shoe the horse was lost.
-            And all for the want of a nail."""
-        @test recite(pieces) == expected
+        @test recite(["nail", "shoe", "horse"]) ==
+              "For want of a nail the shoe was lost.\nFor want of a shoe the horse was lost.\nAnd all for the want of a nail."
     end
 
     @testset "full proverb" begin
-        pieces = ["nail", "shoe", "horse", "rider", "message", "battle", "kingdom"]
-        expected = """
-            For want of a nail the shoe was lost.
-            For want of a shoe the horse was lost.
-            For want of a horse the rider was lost.
-            For want of a rider the message was lost.
-            For want of a message the battle was lost.
-            For want of a battle the kingdom was lost.
-            And all for the want of a nail."""
-        @test recite(pieces) == expected
+        @test recite(["nail", "shoe", "horse", "rider", "message", "battle", "kingdom"]) ==
+              "For want of a nail the shoe was lost.\nFor want of a shoe the horse was lost.\nFor want of a horse the rider was lost.\nFor want of a rider the message was lost.\nFor want of a message the battle was lost.\nFor want of a battle the kingdom was lost.\nAnd all for the want of a nail."
     end
 
     @testset "four pieces modernized" begin
-        pieces = ["pin", "gun", "soldier", "battle"]
-        expected = """
-            For want of a pin the gun was lost.
-            For want of a gun the soldier was lost.
-            For want of a soldier the battle was lost.
-            And all for the want of a pin."""
-        @test recite(pieces) == expected
+        @test recite(["pin", "gun", "soldier", "battle"]) ==
+              "For want of a pin the gun was lost.\nFor want of a gun the soldier was lost.\nFor want of a soldier the battle was lost.\nAnd all for the want of a pin."
     end
 end
diff --git a/exercises/practice/resistor-color-trio/.meta/template.j2 b/exercises/practice/resistor-color-trio/.meta/template.j2
new file mode 100644
index 000000000..27ec89376
--- /dev/null
+++ b/exercises/practice/resistor-color-trio/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test label({{ macros.julia_vector(case["input"]["colors"]) }}) == "{{ case["expected"]["value"] }} {{ case["expected"]["unit"] }}"
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/resistor-color-trio/runtests.jl b/exercises/practice/resistor-color-trio/runtests.jl
index 79d9607b4..04aa2f96b 100644
--- a/exercises/practice/resistor-color-trio/runtests.jl
+++ b/exercises/practice/resistor-color-trio/runtests.jl
@@ -1,3 +1,7 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/resistor-color-trio/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("resistor-color-trio.jl")
@@ -23,26 +27,6 @@ include("resistor-color-trio.jl")
         @test label(["yellow", "violet", "yellow"]) == "470 kiloohms"
     end
 
-    @testset "Orange and orange and red" begin
-        @test label(["orange", "orange", "red"]) == "3.3 kiloohms"
-    end
-
-    @testset "Orange and orange and green" begin
-        @test label(["orange", "orange", "green"]) == "3.3 megaohms"
-    end
-
-    @testset "White and white and violet" begin
-        @test label(["white", "white", "violet"]) == "990 megaohms"
-    end
-
-    @testset "White and white and grey" begin
-        @test label(["white", "white", "grey"]) == "9.9 gigaohms"
-    end
-
-    @testset "White and black and white" begin
-        @test label(["white", "black", "white"]) == "90 gigaohms"
-    end
-
     @testset "Blue and violet and blue" begin
         @test label(["blue", "violet", "blue"]) == "67 megaohms"
     end
diff --git a/exercises/practice/word-count/.meta/template.j2 b/exercises/practice/word-count/.meta/template.j2
new file mode 100644
index 000000000..64d8ca66a
--- /dev/null
+++ b/exercises/practice/word-count/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test wordcount({{ macros.julia_string(case["input"]["sentence"]) }}) == {{ macros.julia_dict(case["expected"]) }}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/word-count/runtests.jl b/exercises/practice/word-count/runtests.jl
index 7347d21b1..061e67a40 100644
--- a/exercises/practice/word-count/runtests.jl
+++ b/exercises/practice/word-count/runtests.jl
@@ -1,12 +1,12 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/word-count/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("word-count.jl")
 
 @testset verbose = true "tests" begin
-    @testset "no words" begin
-        @test wordcount(" .\n,\t!^&*()~@#\$%{}[]:;'/<>") == Dict()
-    end
-
     @testset "count one word" begin
         @test wordcount("word") == Dict("word" => 1)
     end
@@ -16,7 +16,8 @@ include("word-count.jl")
     end
 
     @testset "multiple occurrences of a word" begin
-        @test wordcount("one fish two fish red fish blue fish") == Dict("one" => 1, "fish" => 4, "two" => 1, "red" => 1, "blue" => 1)
+        @test wordcount("one fish two fish red fish blue fish") ==
+              Dict("one" => 1, "fish" => 4, "two" => 1, "red" => 1, "blue" => 1)
     end
 
     @testset "handles cramped lists" begin
@@ -28,7 +29,8 @@ include("word-count.jl")
     end
 
     @testset "ignore punctuation" begin
-        @test wordcount("car: carpet as java: javascript!!&@\$%^&") == Dict("car" => 1, "carpet" => 1, "as" => 1, "java" => 1, "javascript" => 1)
+        @test wordcount("car: carpet as java: javascript!!&@\$%^&") ==
+              Dict("car" => 1, "carpet" => 1, "as" => 1, "java" => 1, "javascript" => 1)
     end
 
     @testset "include numbers" begin
@@ -40,24 +42,30 @@ include("word-count.jl")
     end
 
     @testset "with apostrophes" begin
-        @test wordcount("First: don't laugh. Then: don't cry.") == Dict("first" => 1, "don't" => 2, "laugh" => 1, "then" => 1, "cry" => 1)
-        @test wordcount("Should've could've would've") == Dict("should've" => 1, "could've" => 1, "would've" => 1)
+        @test wordcount("First: don't laugh. Then: don't cry.") ==
+              Dict("first" => 1, "don't" => 2, "laugh" => 1, "then" => 1, "cry" => 1)
     end
 
     @testset "with quotations" begin
-        @test wordcount("Joe can't tell between 'large' and large.") == Dict("joe" => 1, "can't" => 1, "tell" => 1, "between" => 1, "large" => 2, "and" => 1)
+        @test wordcount("Joe can't tell between 'large' and large.") ==
+              Dict("joe" => 1, "can't" => 1, "tell" => 1, "between" => 1, "large" => 2,
+                   "and" => 1)
     end
 
     @testset "substrings from the beginning" begin
-        @test wordcount("Joe can't tell between app, apple and a.") == Dict("joe" => 1, "can't" => 1, "tell" => 1, "between" => 1, "app" => 1, "apple" => 1, "and" => 1, "a" => 1)
+        @test wordcount("Joe can't tell between app, apple and a.") ==
+              Dict("joe" => 1, "can't" => 1, "tell" => 1, "between" => 1, "app" => 1,
+                   "apple" => 1, "and" => 1, "a" => 1)
     end
 
     @testset "multiple spaces not detected as a word" begin
-        @test wordcount(" multiple   whitespaces") == Dict("multiple" => 1, "whitespaces" => 1)
+        @test wordcount(" multiple   whitespaces") ==
+              Dict("multiple" => 1, "whitespaces" => 1)
     end
 
     @testset "alternating word separators not detected as a word" begin
-        @test wordcount(",\n,one,\n ,two \n 'three'") == Dict("one" => 1, "two" => 1, "three" => 1)
+        @test wordcount(",\n,one,\n ,two \n 'three'") ==
+              Dict("one" => 1, "two" => 1, "three" => 1)
     end
 
     @testset "quotation for word with apostrophe" begin
diff --git a/exercises/practice/yacht/.meta/template.j2 b/exercises/practice/yacht/.meta/template.j2
new file mode 100644
index 000000000..336bd823d
--- /dev/null
+++ b/exercises/practice/yacht/.meta/template.j2
@@ -0,0 +1,10 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+
+{{ macros.header() }}
+{% for case in cases %}
+    @testset "{{ case["description"] }}" begin
+        @test score({{ macros.julia_vector(case["input"]["dice"]) }}, "{{ case["input"]["category"] }}") == {{ case["expected"] }}
+    end
+{% endfor %}
+end
diff --git a/exercises/practice/yacht/runtests.jl b/exercises/practice/yacht/runtests.jl
index 540a98fa9..3ec42e086 100644
--- a/exercises/practice/yacht/runtests.jl
+++ b/exercises/practice/yacht/runtests.jl
@@ -1,3 +1,7 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/yacht/canonical-data.json
+# File last updated on 2026-10-24
+
 using Test
 
 include("yacht.jl")
@@ -119,4 +123,3 @@ include("yacht.jl")
         @test score([2, 2, 2, 2, 2], "choice") == 10
     end
 end
-